opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCTAAACAGTGACTTCCAAGATAACTATTATAAAAAAGTCCGGGCTCTCAGTCTCAACGCTGTGGACTTCCAAGACGCTGGCATATATTCTTGTGTGGCCAGCAATGATGTTGGCACACGCACGGCCACCATGAACTTCCAGGTGGTGGAGAGTGCCTACTTAAACTTGACCTCTGAGCAGAGCCTCTTGCAGGAGGTGTCTGTGGGTGACAGCCTCATCCTCACGGTCCATGCAGATGCCTACCCTAGCATACAGCATTACAACTGGACCTACCTAGGTCCATTCTTTGAAGACCAGCGCAAGCTTGAGTTTATCACCCAAAGGGCCATATACAGGTACACATTCAAGCTCTTTCTGAACCGTGTAAAGGCCTCAGAGGCGGGCCAGTACTTCTTAATGGCACAAAACAAGGCAGGCTGGAATAATCTGACCTTTGAGCTCACCCTGCGATATCCCCCAGAGGTCAGTGTTACATGGATGCCTGTGAATGGCTCTGATGTCCTGTTCTGTGACG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... CSF1R(12978), Csf1r(12978)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Yang Gyun Kim et al.
PloS one, 10(9), e0137044-e0137044 (2015-09-09)
A proliferation-inducing ligand (APRIL) is a member of the tumor necrosis factor (TNF) superfamily. Despite advances in clinical and genetic studies, the details of the pathological roles of APRIL in IgA nephropathy (IgAN) remain to be fully defined. The present...
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.