opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATTGTCATGGACTCGGGAATATGGCCAGAGCAGGCCCAGAGGCACAAAACCCACTTCCATCACCCAAACAAGTTACACTTGAGAGTGGTGACACTGATTGAACATCCATTTGTTTTCACGAGAGAAGTAGATGATGAAGGCTTATGCCCTGCTGGACAACTCTGTCTAGACCCTATGACTAATGACTCTTCCATACTGGATAGCCTGTTTAGCAGCCTACATAGCAGTAATGATACAGTGCCAATCAAGTTCAAGAAGTGCTGCTATGGGTATTGCATTGATCTACTGGAACAGTTAGCAGAAGACATGAACTTTGACTTTGACCTCTATATTGTAGGGGATGGAAAGTATGGAGCTTGGAAAAATGGTCACTGGACTGGGCTGGTTGGTGATCTCCTGAGTGGAACAGCCAACATGGCAGTCACTTCTTTCAGCATCAATACTGCAAGAAGCCAAGTGATAGATTTCACCAGCCCTTTCTTCTCAACCAGTTTGGGCATCTTAGTGAGGA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

wysyłka w ciągu

ambient

temp. przechowywania

−20°C

Gene Information

mouse ... GRIN3A(242443), Grin3a(242443)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Liang-Fu Chen et al.
The Journal of biological chemistry, 295(25), 8613-8627 (2020-05-13)
N-Methyl-d-aspartate type glutamate receptors (NMDARs) are key mediators of synaptic activity-regulated gene transcription in neurons, both during development and in the adult brain. Developmental differences in the glutamate receptor ionotropic NMDA 2 (GluN2) subunit composition of NMDARs determines whether they...

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.