HLTUD0559

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Human

hsa-miR-411-3p

Synonim(y):
hsa-miR-411*, Tough Decoy, TuD
NACRES:
NA.51

Poziom jakości

200

linia produktu

MISSION®

stężenie

≥1x106 VP/ml (via p24 assay)

zastosowania

capture ELISA: 106 TU/mL using p24 (Volume 200 uL)

sekwencja dojrzała

UAUGUAACACGGUCCACUAACC

numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych

numer dostępu Sanger microRNA

wysyłka w ciągu

dry ice

temp. przechowywania

−70°C

Opis ogólny

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Inne uwagi

Based on miRBase V19 Mature ID

Informacje prawne

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

UN 3245 9

WGK Germany

WGK 3

Temperatura zapłonu °F

Not applicable

Temperatura zapłonu °C

Not applicable

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.