EHU002381

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN2, RAB4B-EGLN2

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGCAGCTATGTCATCAACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAGTGGCCAGTCCCAGAGCCGCATGGCAGACAGCTTAAATGACTTCAGGAGAGCCCTGGGCCTGTGCTGGCTGCTCCTTCCCTGCCACCGCTGCTGCTTCTGACTTTGCCTCTGTCCTGCCTGGTGTGGAGGGCTCTGTCTGTTGCTGAGGACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point F

Not applicable

Flash Point C

Not applicable

Certificate of Analysis

Certificate of Origin

Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management...
Ling Li et al.
The Journal of clinical investigation, 129(6), 2374-2389 (2019-03-27)
Acute kidney injury (AKI) can lead to chronic kidney disease (CKD) if injury is severe and/or repair is incomplete. However, the pathogenesis of CKD following renal ischemic injury is not fully understood. Capillary rarefaction and tubular hypoxia are common findings...
R V Durán et al.
Oncogene, 32(38), 4549-4556 (2012-10-23)
Hypoxia-inducible factor (HIF) prolyl hydroxylases (PHDs) are α-ketoglutarate (αKG)-dependent dioxygenases that function as cellular oxygen sensors. However, PHD activity also depends on factors other than oxygen, especially αKG, a key metabolic compound closely linked to amino-acid metabolism. We examined the...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.