EHU027041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIAH2

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCATACGGAGAAACCAGAACATGAAGACATATGTGAATACCGTCCCTACTCCTGCCCATGTCCTGGTGCTTCCTGCAAGTGGCAGGGGTCCCTGGAAGCTGTGATGTCCCATCTCATGCACGCCCACAAGAGCATTACCACCCTTCAGGGAGAAGACATCGTCTTTCTAGCTACAGACATTAACTTGCCAGGGGCTGTCGACTGGGTGATGATGCAGTCATGTTTTGGCCATCACTTCATGCTGGTGCTGGAGAAACAAGAGAAGTACGAAGGCCACCAGCAGTTTTTTGCCATCGTCCTGCTCATTGGCACCCGCAAGCAAGCCGAGAACTTTGCCTACAGACTGGAGTTGAATGGGAACCGGCGGAGATTGACCTGGGAGGCCACGCCCCGTTCGATTCATGACGGTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Flash Point F

Not applicable

Flash Point C

Not applicable

Certificate of Analysis

Certificate of Origin

Yang He et al.
Molecular cancer research : MCR, 17(5), 1129-1141 (2019-02-24)
Patients suffering from glioblastoma have a dismal prognosis, indicating the need for new therapeutic targets. Here we provide evidence that the DNA damage kinase HIPK2 and its negative regulatory E3-ubiquitin ligase SIAH1 are critical factors controlling temozolomide-induced cell death. We...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service