Merck
All Photos(1)

EHU096781

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (3)

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTGCAGTGTAAGAAAATTGGACTGTAATCATATCGCTACTGGCATCTGTTATCTAGTATGCATTTCTGGTGTGTATCTGAAAGGAAGACATTTTCTACCCTAGATCCAATTGCATTTATTTATCAATAAGTGCCATTAAATTGAAATTATATTACATTTTACACTTTCTCAATGAATGAACAAATTAGTCTGTAGAATCTAGCCACCTGTTTAGCCTAGTCATGTGCCTTGAACATATATGTGTCCCATAATCTGGCTCATGGTACCTGTTCTTCTATCCAAACCTTTCAATTCATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service