EHU013431

Sigma-Aldrich

MISSION® esiRNA

targeting human RAD18

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCAGGGGAGCAGGTTAATGGATAATTTCTTGATCAGAGAAATGAGTGGTTCTACATCAGAGTTGTTGATAAAAGAAAATAAAAGCAAATTCAGCCCTCAAAAAGAGGCGAGCCCTGCTGCAAAGACCAAAGAGACACGTTCTGTAGAAGAGATCGCTCCAGATCCCTCAGAGGCTAAGCGTCCTGAGCCACCCTCGACATCCACTTTGAAACAAGTTACTAAAGTGGATTGTCCTGTTTGCGGGGTTAACATTCCAGAAAGTCACATTAATAAGCATTTAGACAGCTGTTTATCACGCGAAGAGAAGAAGGAAAGCCTCAGAAGTTCTGTTCACAAAAGGAAGCCGCTGCCCAAAACTGTATATAATTTGCTCTCTGATCGTGATTTAAAGAAAAAGCTAAAAGAGCATGGATTATCTATTCAAGGAAATAAACAACAGCTCATTAAAAGGCACCAAGAATTTGTACACATGTACAATGCCCAATGCGATGCTTTGCATCCTAAATCAGCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAD18(56852), RAD18(56852)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Megumi Sasatani et al.
PloS one, 10(2), e0117845-e0117845 (2015-02-13)
The ubiquitin ligase RAD18 is involved in post replication repair pathways via its recruitment to stalled replication forks, and its role in the ubiquitylation of proliferating cell nuclear antigen (PCNA). Recently, it has been reported that RAD18 is also recruited...
Chen Xie et al.
Journal of cellular physiology, 234(11), 21100-21112 (2019-05-14)
This study aimed at investigating the role of RAD18 in the regulation of glioblastoma development as well as the underlying mechanisms. The human glioblastoma U251 and U87MG cells were transfected with siRNAs specifically targeting RAD18, and the effects of knockdown...
Thomas Göhler et al.
The Journal of cell biology, 192(2), 219-227 (2011-01-19)
DNA polymerase η (polη) belongs to the Y-family of DNA polymerases and facilitates translesion synthesis past UV damage. We show that, after UV irradiation, polη becomes phosphorylated at Ser601 by the ataxia-telangiectasia mutated and Rad3-related (ATR) kinase. DNA damage-induced phosphorylation...
Ainhoa Nieto et al.
Cell death and differentiation, 27(4), 1200-1213 (2019-09-12)
Cellular DNA is constantly under threat from internal and external insults, consequently multiple pathways have evolved to maintain chromosomal fidelity. Our previous studies revealed that chronic stress, mediated by continuous stimulation of the β2-adrenergic-βarrestin-1 signaling axis suppresses activity of the...
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.