EHU051971

Sigma-Aldrich

MISSION® esiRNA

targeting human CD69

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAATAAGGAAACATGTTCACTTATTGACTATTATAGAATGGAACTCAAGGAAATCTGTGTCAGTGGATGCTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD69(969), CD69(969)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Haiyan Hu et al.
Molecular medicine reports, 18(3), 3085-3092 (2018-07-18)
Cardiac fibrosis is characterized as net accumulation of ECM (extracellular matrix) proteins in the cardiac interstitium, which contributes to dysfunction of both systolic and diastolic. The present study aimed to identify the association between microRNA (miR)‑367‑3p and cluster of differentiation 69...
Lei Yu et al.
Cell death & disease, 9(9), 905-905 (2018-09-07)
Foxp3+ regulatory T cells (Tregs) can inhibit immune responses and maintain immune tolerance by secreting immunosuppressive TGF-β1 and IL-10. However, the efficiency of Tregs become the major obstacle to their use for immunotherapy. In this study, we investigated the relevance...
Yuki Miyamoto et al.
Nature communications, 7, 13478-13478 (2016-11-24)
Oligodendrocytes differentiate to wrap their plasma membranes around axons, forming the myelin sheath. A neuronal cue is one of the regulator elements controlling this process. Here, we demonstrate that VCAM1, which plays a key role throughout the immune system, is...
Shih-Yun Huang et al.
Journal of cellular physiology, 233(9), 7467-7479 (2018-04-18)
Chronic myeloid leukemia (CML) is caused by a constitutively active BCR-ABL tyrosine kinase. Tyrosine kinase inhibitors (TKIs) imatinib and its derivatives represent a breakthrough for CML therapy, but the use of TKI alone is ineffective for many CML patients. CD69...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.