EHU052611

Sigma-Aldrich

MISSION® esiRNA

targeting human CD99

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATTGTCGGCAGAAACAGCCCAGGCGTTGGCAGCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAGATGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTTGCTGGGCGGATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGGACCCCCATTCTCCAAGGCCCGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATTATTAAGTCCCTGTAACTCAAATGTCAACCCCACCGAGGCACCCCCCCGTCCCCCAGAATCTTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTGAAACCCCTGGTAGCCCCGACTTCTTTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD99(4267), CD99(4267)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Lais C Cardoso et al.
International journal of molecular sciences, 20(5) (2019-03-09)
Glioblastoma (GBM) is the most aggressive type of brain tumor, with an overall survival of 17 months under the current standard of care therapy. CD99, an over-expressed transmembrane protein in several malignancies, has been considered a potential target for immunotherapy....
Tillmann Bedau et al.
Oncotarget, 8(33), 54873-54888 (2017-09-15)
Transendothelial cell migration (TEM) is crucial for inflammation and metastasis. The adhesion molecule CD99 was shown to be important for correct immune cell extravasation and is highly expressed on certain cancer cells. Recently, we demonstrated that ectodomain shedding of CD99...
Jianfa Wu et al.
Biochemical and biophysical research communications, 518(4), 698-705 (2019-09-02)
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.