EHU056151

Sigma-Aldrich

MISSION® esiRNA

targeting human SPOP

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGCGAGTAAACCCCAAAGGGTTAGATGAAGAAAGCAAAGATTACCTGTCACTTTACCTGTTACTGGTCAGCTGTCCAAAGAGTGAAGTTCGGGCAAAATTCAAATTCTCCATCCTGAATGCCAAGGGAGAAGAAACCAAAGCTATGGAGAGTCAACGGGCATATAGGTTTGTGCAAGGCAAAGACTGGGGATTCAAGAAATTCATCCGTAGAGATTTTCTTTTGGATGAGGCCAACGGGCTTCTCCCTGATGACAAGCTTACCCTCTTCTGCGAGGTGAGTGTTGTGCAAGATTCTGTCAACATTTCTGGCCAGAATACCATGAACATGGTAAAGGTTCCTGAGTGCCGGCTGGCAGATGAGTTAGGAGGACTGTGGGAGAATTCCCGGTTCACAGACTGCTGCTTGTGTGTTGCCGGCCAGGAATTCCAGGCTCACAAGGCTAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SPOP(8405), SPOP(8405)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Rihan El Bezawy et al.
Cancers, 12(6) (2020-06-10)
Speckle-type POZ (pox virus and zinc finger protein) protein (SPOP) is the most commonly mutated gene in prostate cancer (PCa). Recent evidence reports a role of SPOP in DNA damage response (DDR), indicating a possible impact of SPOP deregulation on...
Dan Zhang et al.
Carcinogenesis, 35(8), 1691-1697 (2014-01-24)
Speckle-type POZ protein (SPOP) is an adaptor of the cullin 3-based ubiquitin ligase responsible for the degradation of oncoproteins frequently overexpressed in many tumor cells. Altered expression and somatic mutations of SPOP have been observed in various tumor types with...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.