EHU058981

Sigma-Aldrich

MISSION® esiRNA

targeting human DTNBP1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGCCTGAGGAGAGGAGACCGGCGGCGGCGGCAATGCTGGAGACCCTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGGGCTGAAGACTTTAAGTGACAAGTCAAGAGAAGCAAAAGTGAAAAGCAAACCCAGGACTGTTCCATTTTTGCCAAAGTACTCTGCTGGATTAGAATTACTTAGCAGGTATGAGGATACATGGGCTGCACTTCACAGAAGAGCCAAAGACTGTGCAAGTGCTGGAGAGCTGGTGGATAGCGAGGTGGTCATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTCCCAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAGGTAGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAGTCCCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DTNBP1(84062), DTNBP1(84062)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Shruti Sharma et al.
Nature communications, 10(1), 3105-3105 (2019-07-17)
Fas plays a major role in regulating ligand-induced apoptosis in many cell types. It is well known that several cancers demonstrate reduced cell surface levels of Fas and thus escape a potential control system via ligand-induced apoptosis, although underlying mechanisms...
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.