EHU059001

Sigma-Aldrich

MISSION® esiRNA

targeting human DUOXA1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCCTGGGTGAGAACTATGCTGAGGAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTGTGTTGTACCTAGCTGAGAAGTTCACTCCAAGAAGCCCATGTGGCCTATACCGCCAGTACCGCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGCATTCCTCTGCTGGCTGCTGGCCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTATTGGCCACGGGCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCTGTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCACATTGACCACAGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGATGCAGCCTCACAGGCTGAAGGCTTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DUOXA1(90527), DUOXA1(90527)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Zheng Dong et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(11), 1903630-1903630 (2020-06-17)
Arsenic (As) is a widespread metalloid contaminant, and its internal exposure is demonstrated to cause serious detrimental health problems. Albeit considerable studies are performed to interrogate the molecular mechanisms responsible for As-induced toxicities, the exact mechanisms are not fully understood...
Ning Xiao et al.
Toxicology letters, 292, 97-107 (2018-05-01)
Overexposure to methamphetamine (METH) causes apoptosis in a number of cell types, particularly neuronal cells. However, the underlying mechanisms of METH-induced neuronal apoptosis remain to be elucidated. Accumulation of microtubule-associated protein Tau can lead to activation of multiple neurotoxic pathways...
Lizeng Li et al.
Toxicology research, 7(2), 221-234 (2018-08-10)
Methamphetamine (METH) is well-known as a potent psychostimulant of abuse worldwide. METH administration can cause neurotoxicity and neurodegenerative injury, which are similar to the two prevalent neurodegenerative disorders Alzheimer's disease (AD) and Parkinson's disease (PD). Recent results suggested that METH...
Si-Hao Du et al.
Frontiers in molecular neuroscience, 10, 409-409 (2018-01-10)
Methamphetamine (METH) is an amphetamine-typed stimulant drug that is increasingly being abused worldwide. Previous studies have shown that METH toxicity is systemic, especially targeting dopaminergic neurons in the central nervous system (CNS). However, the role of neuroinflammation in METH neurotoxicity...
Shenghang Jin et al.
Oncology letters, 17(5), 4675-4682 (2019-04-05)
The mechanism responsible for the initiation of tumor metastasis and epithelial-mesenchymal transition (EMT) is not well understood. During EMT, epithelial cells lose their polarity and adhesion to surrounding cells and migrate, resulting in transition into mesenchymal cells. Canonical Wnt signaling...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.