EHU060601

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNMT1(1786), DNMT1(1786)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation...
Fangcao Jin et al.
Stem cell research & therapy, 11(1), 444-444 (2020-10-21)
Dysfunction of the DNA methylation was associated with stem cell reprogramming. Moreover, DNA methyltransferase 1 (DNMT1) deficiency was involved in the differentiation of hair follicle stem cell (HFSc), but the molecular mechanisms remain unknown. HFSc from human scalp tissues were...
Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long...
Luc Gailhouste et al.
Cell death & disease, 9(5), 468-468 (2018-04-28)
Curative management of pancreatic adenocarcinoma is limited because this malignancy remains resistant to most chemotherapeutic drugs. Strategies that reverse epigenetic alterations offer a unique opportunity for cancer cell reprogramming, which is valuable for development of new treatments. The aim of...
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.