EHU060821

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK9

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PCSK9(255738), PCSK9(255738)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Xiaohui Xu et al.
Experimental and therapeutic medicine, 13(5), 1993-1999 (2017-06-02)
Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of the subtilisin family of PCs that encodes a neural apoptosis-regulated convertase 1. However, the precise role of PCSK9 in lung cancer cell apoptosis has remained elusive. In the present study...
Yanting Zou et al.
Inflammation, 43(1), 251-263 (2019-11-30)
Lipopolysaccharide (LPS) is demonstrated to cause "two-hit" injury to liver. Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays an important role in LPS clearance. Hepatocyte nuclear factor-1 alpha (HNF-1α) and sterol regulatory element-binding protein 2 (SREBP2) were reported to be responsible...
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors...
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.