EHU061351

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4L

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTGCCACGGACAACTACACCCTTCAGATCAACCCTAATTCAGGCCTCTGTAATGAGGATCATTTGTCCTACTTCACTTTTATTGGAAGAGTTGCTGGTCTGGCCGTATTTCATGGGAAGCTCTTAGATGGTTTCTTCATTAGACCATTTTACAAGATGATGTTGGGAAAGCAGATAACCCTGAATGACATGGAATCTGTGGATAGTGAATATTACAACTCTTTGAAATGGATCCTGGAGAATGACCCTACTGAGCTGGACCTCATGTTCTGCATAGACGAAGAAAACTTTGGACAGACATATCAAGTGGATTTGAAGCCCAATGGGTCAGAAATAATGGTCACAAATGAAAACAAAAGGGAATATATCGACTTAGTCATCCAGTGGAGATTTGTGAACAGGGTCCAGAAGCAGATG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NEDD4L(23327), NEDD4L(23327)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
null
Neil J Grimsey et al.
Cell reports, 24(12), 3312-3323 (2018-09-21)
Ubiquitination is essential for protein degradation and signaling and pivotal to many physiological processes. Ubiquitination of a subset of G-protein-coupled receptors (GPCRs) by the E3 ligase NEDD4-2 is required for p38 activation, but how GPCRs activate NEDD4-2 to promote ubiquitin-mediated...
Dong-Eun Lee et al.
Cell death & disease, 11(1), 38-38 (2020-01-22)
In mammals, autophagosome formation is initiated by ULK1 via the posttranslational modification of this protein. However, the precise role of ULK1 ubiquitination in modulating autophagy is unknown. Here, we show that NEDD4L, an E3 ubiquitin ligase, binds ULK1 in pancreatic...
Cheng-Yu Tsai et al.
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.