EHU062481

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK3

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK3(5595), MAPK3(5595)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Osamu Otabe et al.
Oncology reports, 37(1), 98-104 (2016-11-15)
In alveolar rhabdomyosarcoma (ARMS) that is a highly malignant pediatric soft tissue tumor, MET, a receptor of hepatocyte growth factor (HGF), was reported to be downstream of the PAX3-FOXO1 fusion gene specific to ARMS, and a key mediator of metastatic...
Nicolas Ricard et al.
Cells, 9(1) (2019-12-28)
Despite the clinical importance of arteriogenesis, this biological process is poorly understood. ERK1 and ERK2 are key components of a major intracellular signaling pathway activated by vascular endothelial growth (VEGF) and FGF2, growth factors critical to arteriogenesis. To investigate the...
Yunching Chen et al.
Scientific reports, 7, 44123-44123 (2017-03-10)
Sorafenib is a RAF inhibitor approved for several cancers, including hepatocellular carcinoma (HCC). Inhibition of RAF kinases can induce a dose-dependent "paradoxical" upregulation of the downstream mitogen-activated protein kinase (MAPK) pathway in cancer cells. It is unknown whether "paradoxical" ERK...
Zhen Liu et al.
EBioMedicine, 42, 326-339 (2019-03-19)
Crizotinib has potent anti-tumor activity in patients with advanced MET-amplified non-small cell lung cancer (NSCLC). However, the therapeutic effect is still not satisfying. Thus, developing approaches that improve the efficacy of crizotinib remains a significant challenge. MET-amplified NSCLC cell lines...
Takeshi Koujima et al.
Molecular therapy oncolytics, 17, 107-117 (2020-04-24)
Pancreatic ductal adenocarcinoma (PDAC) cells have an exceptional ability to invade nerves through pronounced crosstalk between nerves and cancer cells; however, the mechanism of PDAC cell invasion remains to be elucidated. Here, we demonstrate the therapeutic potential of telomerase-specific oncolytic...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.