EHU062731

Sigma-Aldrich

MISSION® esiRNA

targeting human PHF8

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCGCCATCATTCACTGTGAGGGATGTTGAACACTATGTTGGTTCTGACAAAGAGATTGATGTGATTGATGTGACCCGCCAGGCTGACTGCAAGATGAAGCTTGGTGATTTTGTGAAATACTATTACAGCGGGAAGAGGGAGAAAGTCCTCAATGTCATTAGTTTGGAATTCTCTGATACCAGACTTTCTAACCTTGTGGAGACACCGAAGATTGTTCGAAAGCTGTCATGGGTCGAAAACTTGTGGCCAGAGGAATGTGTCTTTGAGAGACCCAATGTACAGAAGTACTGCCTCATGAGTGTGCGAGATAGCTATACAGACTTTCACATTGACTTTGGTGGCACCTCTGTCTGGTACCATGTACTCAAGGGTGAAAAGATCTTCTACCTGATCCGCCCAACAAATGCCAATCTGACTCTCTTTGAGTGCTGGAGCAGTTCCTCTAATCAGAATGAGATGTTCTTTGGGGACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PHF8(23133), PHF8(23133)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
null
D Tong et al.
Oncogenesis, 5(12), e283-e283 (2016-12-20)
Recent studies provide strong evidence that the androgen receptor (AR) signaling pathway remains active in castration-resistant prostate cancer (CRPC). However, the underlying mechanisms are not well understood. In this study, we demonstrate that plant homeo domain finger protein 8 (PHF8...
Peterson Kariuki Maina et al.
Oncotarget, 7(46), 75585-75602 (2016-10-01)
Epigenetic factors play critical roles in prostate cancer (PCa) development. However, how they contribute to neuroendocrine differentiation (NED) and castration-resistant PCa (CRPC) is not fully understood. Using bioinformatics and biochemical approaches to analyze cell-based models of NED and CRPC, we...
Matthias S Leisegang et al.
FEBS letters, 593(5), 487-498 (2019-02-14)
Histone3-lysine9 (H3K9) residues not only control gene expression, but also contribute to RNA splicing. Here, the H3K9 histone demethylase PHF8 was investigated in endothelial cells for its involvement in alternative splicing. An angiogenic sprouting assay shows the importance of PHF8...
Peterson Kariuki Maina et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1860(9), 1002-1012 (2017-07-25)
Hypoxia through transcription factor HIF1α plays a critical role in cancer development. In prostate cancer, HIF1α interplays with androgen receptor (AR) to contribute to the progression of this disease to its lethal form-castration-resistant prostate cancer (CRPC). Hypoxia upregulates several epigenetic...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.