EHU063211

Sigma-Aldrich

MISSION® esiRNA

targeting human LETM1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAGTTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTGCCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCCACATTTGAGACTCAGTCACTCAAGGAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGACACCATCGAGGAGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LETM1(3954), LETM1(3954)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

WGK Germany

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Lihua Piao et al.
Cancer management and research, 12, 1649-1660 (2020-03-19)
The leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is a mitochondrial protein that has been associated with the occurrence and development of malignant tumors. Previous studies have shown that LETM1 expression is increased in several types of human cancer and...
Haoyue Li et al.
Experimental and molecular pathology, 112, 104333-104333 (2019-11-11)
Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is closely linked to the occurrence and development of many malignant tumors. Many studies have reported that enhanced expression of LETM1 in several types of human cancers was associated with poor clinical outcomes;...
Lesley Hart et al.
Disease models & mechanisms, 7(5), 535-545 (2014-03-15)
Wolf-Hirschhorn syndrome (WHS) represents an archetypical example of a contiguous gene deletion disorder - a condition comprising a complex set of developmental phenotypes with a multigenic origin. Epileptic seizures, intellectual disability, growth restriction, motor delay and hypotonia are major co-morbidities...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.