EHU071181

Sigma-Aldrich

MISSION® esiRNA

targeting human PLCE1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGATTTCCTCGTGAATTGCCAAGGAGAACACTGCACTTATGATGAAATCCTCAGCATCATCCAGAAGTTCGAGCCTAGCATCAGTATGTGTCATCAGGGACTAATGTCATTTGAAGGGTTTGCCAGGTTTCTGATGGATAAAGAAAATTTTGCCTCAAAAAATGATGAGTCACAGGAGAACATTAAAGAACTGCAGCTACCCCTCTCATACTATTACATCGAATCTTCGCACAATACCTACCTCACGGGCCATCAGCTCAAAGGAGAATCCTCGGTAGAACTCTACAGCCAGGTCCTTTTGCAAGGCTGTCGAAGTGTAGAATTGGACTGCTGGGACGGAGACGATGGGATGCCCATCATTTATCATGGACATACGCTGACAACCAAGATCCCCTTCAAGGAAGTGGTTGAAGCCATTGATCGCAGTGCCTTCATCAACTCTGACCTGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PLCE1(51196), PLCE1(51196)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Xiaobin Cui et al.
Molecular and cellular biochemistry, 442(1-2), 111-127 (2017-12-15)
Phospholipase C epsilon 1 (PLCE1) has been recognized as a novel susceptibility marker for esophageal squamous cell carcinoma (ESCC). The purpose of our study is to investigate its effect on the regulation of miRNA expression so as to translating the...
Chun Tang et al.
Journal of cellular biochemistry, 120(6), 10678-10687 (2019-01-18)
Esophageal squamous cell carcinoma (ESCC) is the leading pathologic type in China. miR-145 has been reported to be downregulated in multiple tumors. This study was aimed to investigate the role of miR-145 in ESCC. miR-145 expression was investigated in 65...
Xiao-Bin Cui et al.
Oncotarget, 8(54), 92454-92469 (2017-12-02)
Esophageal squamous cell carcinoma (ESCC) is one of the frequent malignant tumors with poor prognosis worldwide. Identifying the prognostic biomarkers and potential mechanisms of such tumors has attracted increasing interest in esophageal cancer biology. Our previous study showed that phospholipase...
Yunzhao Chen et al.
Cancer research, 80(11), 2175-2189 (2020-02-19)
Esophageal squamous cell carcinoma (ESCC) is one of the deadliest malignant diseases. Multiple studies with large clinic-based cohorts have revealed that variations of phospholipase C epsilon 1 (PLCE1) correlate with esophageal cancer susceptibility. However, the causative role of PLCE1 in...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.