EHU072911

Sigma-Aldrich

MISSION® esiRNA

targeting human FOSL2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCTGGGGATTCAGCTCTAGAGGTCACAGTATCCTCGTTTGAAAGATAATTAAGATCCCCCGTGGAGAAAGCAGTGACACATTCACACAGCTGTTCCCTCGCATGTTATTTCATGAACATGACCTGTTTTCGTGCACTAGACACACAGAGTGGAACAGCCGTATGCTTAAAGTACATGGGCCAGTGGGACTGGAAGTGACCTGTACAAGTGATGCAGAAAGGAGGGTTTCAAAGAAAAAGGATTTTGTTTAAAATACTTTAAAAATGTTATTTCCTGCATCCCTTGGCTGTGATGCCCCTCTCCCGATTTCCCAGGGGCTCTGGGAGGGACCCTTCTAAGAAGATTGGGCAGTTGGGTTTCTGGCTTGAGATGAATCCAAGCAGCAGAATGAGCCAGGAGTAGCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FOSL2(2355), FOSL2(2355)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Lan Ling et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 411-419 (2018-05-23)
Hepatocyte proliferation and apoptosis are critical cellular behaviors in rat liver as a result of a liver injury. Herein, we performed this study in order to evaluate the role of miR-30e and its target Fos-Related Antigen-2 (FOSL2) in septic rats...
Shuo Li et al.
Experimental cell research, 373(1-2), 57-61 (2018-08-17)
Among different cancers, incidence and mortality of colorectal cancer (CRC) is one of the highest. KRAS mutation is one of the underlying features in the pathogenesis of CRC with CRC tumors harboring mutant KRAS exhibiting a more aggressive behavior compared...
Poonam Sarode et al.
Science advances, 6(23), eaaz6105-eaaz6105 (2020-06-18)
Tumor-associated macrophages (TAMs) influence lung tumor development by inducing immunosuppression. Transcriptome analysis of TAMs isolated from human lung tumor tissues revealed an up-regulation of the Wnt/β-catenin pathway. These findings were reproduced in a newly developed in vitro "trained" TAM model....
null
Jon M Carthy et al.
Journal of cellular physiology, 230(12), 3084-3092 (2015-06-23)
Transforming growth factor-β (TGF-β) is a multifunctional cytokine which stimulates the differentiation of fibroblasts into myofibroblasts. Myofibroblasts are critical for normal wound healing, but also accumulate pathologically in a number of chronic inflammatory conditions where they are key contributors to...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.