EHU074231

Sigma-Aldrich

MISSION® esiRNA

targeting human NFASC

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGCATTTCCAAAGGATGCCTTTCTCGCCATATGCCTCCCCTGGCCCCCAGCCCCTCTGCCTCGGCCTTGTCAGTTGCTGAGCTGGGCTTGGCTCCTTTCTGGAAAATGACAGTATTTTTGGCAGGGAGAAGGTGCGCAGGCCTCCTTGCTGCTCTCTGGTTTGGTTGGGAGGTGTGTTTACCTCTTGCTCCTCATTCCTCCCCTGCCCTTTTCTCTGGAATATCTAAGATGTGAGCTGCATTGACTCTGAAGACGTTTGAGGAACAGGAGTGGGCACTGATAGAAAGGACTTCAACGCCAGTGACTGTGTACCTCCAGCAGAAGAAAATCAGGTGTCTGGTCTTGGGGGCACTGTGCTCACTTCTAGAGAGAAGAAAAAGGCTGGGTTTGGACTTCATGCCTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NFASC(23114), NFASC(23114)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Chang Hoon Bae et al.
Clinical and experimental otorhinolaryngology, 11(2), 124-132 (2018-01-11)
Clusterin (CLU) is known as apolipoprotein J, and has three isoforms with different biological functions. CLU is associated with various diseases such as Alzheimer disease, atherosclerosis, and some malignancies. Recent studies report an association of CLU with inflammation and immune...
T-Y Lin et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 44(11), 1347-1360 (2014-09-27)
Infiltration of fibrocytes (FC) in the airway smooth muscle is a feature of asthma, but the pathological significance is unknown. We sought to explore whether FC modulate the phenotype of airway smooth muscle cells (ASMC) in asthmatic vs. control subjects....
Andrea Martello et al.
EMBO reports, 21(7), e48192-e48192 (2020-04-28)
Autophagy is an essential cellular quality control process that has emerged as a critical one for vascular homeostasis. Here, we show that trichoplein (TCHP) links autophagy with endothelial cell (EC) function. TCHP localizes to centriolar satellites, where it binds and...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.