EHU078741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAB2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCCCAAACAATGACTTCCTGCCATGTTTGATGGGGACAGCTACCACTGTCCTCTGCCCCCATTCCCCTTTCAGCTCCCATGAGCATGCATAGTTCACCAGACCAATGGCCTAGCCATTCTCTAAGTCCCATCCTGGAAGAAGTTATTTCTTCAAGAGCTGCACCTCTCCTCCTAGCATTAGTTTAGATCAACTCAAGGAGTATTTATTAATGGCTGCTGTCTCCAGTTTCTGGGGTTAAGCACTAAGGACACAAGAATCAATCAGACCTTCTCCCTGAACTTAAGATAGCCACAATCAGAAAAAGGACAAGGACATGAGACAGTGGTGATGGCCATCAGACAGAGACTTCAAATGCTGATGGAGGGCAGAGGAAGTACTTAGGGAGGTTGGTGTCAGAGGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GAB2(9846), GAB2(9846)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Yiping Huang et al.
Biochemical and biophysical research communications, 503(3), 2028-2032 (2018-08-11)
The functionality of lncRNA snaR has only been characterized in breast cancer and colon cancer. The aim of the current study is to explore the involvement of lncRNA snaR in ovarian carcinoma (OC). Expression of lncRNA snaR and GRB2-associated binding...
Wen Jie Wang et al.
International journal of clinical and experimental pathology, 8(9), 10575-10584 (2015-12-01)
Non-small cell lung cancer (NSCLC) is a leading cause of cancer-related death and often has a poor prognosis. Investigation of NSCLC cancer cell migration, invasion and development of strategies to block this process is essential to improve the disease prognosis....
Lan Yang et al.
The Journal of biological chemistry, 290(44), 26627-26637 (2015-09-12)
Proteinase activated-receptor 2 (PAR2) participates in cancer metastasis promoted by serine proteinases. The current study aimed to test the molecular mechanism by which PAR2 promotes cancer cell migration. In different cancer cells, activation of PAR2 by activating peptide (PAR2-AP) dramatically...
Peng Zhang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(1), 52-65 (2018-10-17)
HER2 has been implicated in mammary tumorigenesis as well as aggressive tumor growth and metastasis. Its overexpression is related to a poor prognosis and chemoresistance in breast cancer patients. Although Grb2-associated binding protein 2 (Gab2) is important in the development...
Jiuhong Ma et al.
Oncology reports, 37(2), 1159-1167 (2016-12-22)
Glioma is the most frequent and aggressive primary tumor of the brain in humans. Over the last few decades, significant progress has been made in early detection and multi-mode treatments, but the prognosis of gliomas is still extremely poor. MicroRNAs...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.