EHU079301

Sigma-Aldrich

MISSION® esiRNA

targeting human LARGE1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGGCTGGCTGTTTTACACCGGTCACATTTTCTATTGGCAGTGACTGATTCATGGGAAAGGGCTTTGAAGGAACTACTTCAGTGCACACACAAGGTACGAACCTCTCAGGCCTTTCGAAGAACTTTCATAATTCATGAAAGCCCAGTTCTGAAGATTCACGTATCCATCTGGAGACCTACAGGAAGAAAGTGATTGGGTTCCTCTGGTTCTTGCCTGCTTCACTGTGGATGGGAAGAGGTGACAACCTCAGTCTCCCTTTGGGACCTGTCCAAGGGTAGGCAACCACCTTCACCTTCACACAGATTGAGGAGACACTGGACTTTTTACCCATTTTCTTTAATCTTCAATATTAATATTGTGTTTACATTGATGAGAACAAGAGTTAATGCCCTACCCTCTGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LARGE1(9215), LARGE(9215)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
María Eugenia de la Morena-Barrio et al.
PloS one, 8(5), e64998-e64998 (2013-05-25)
The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin...
Pei J Lu et al.
Scientific reports, 10(1), 4935-4935 (2020-03-20)
The laminin-binding glycan (matriglycan) on α-dystroglycan (α-DG) enables diverse roles, from neuronal development to muscle integrity. Reduction or loss of matriglycan has also been implicated in cancer development and metastasis, and specifically associated with high-grade tumors and poor prognoses in...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.