EHU085731

Sigma-Aldrich

MISSION® esiRNA

targeting human MKNK2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGCCTTCTCCCTAGACCAGCCCGACCACGGAGACTCTGACTTTGGCCTGCAGTGCTCAGCCCGCCCTGACATGCCCGCCAGCCAGCCCATTGACATCCCGGACGCCAAGAAGAGGGGCAAGAAGAAGAAGCGCGGCCGGGCCACCGACAGCTTCTCGGGCAGGTTTGAAGACGTCTACCAGCTGCAGGAAGATGTGCTGGGGGAGGGCGCTCATGCCCGAGTGCAGACCTGCATCAACCTGATCACCAGCCAGGAGTACGCCGTCAAGATCATTGAGAAGCAGCCAGGCCACATTCGGAGCAGGGTTTTCAGGGAGGTGGAGATGCTGTACCAGTGCCAGGGACACAGGAACGTCCTAGAGCTGATTGAGTTCTTCGAGGAGGAGGACCGCTTCTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MKNK2(2872), MKNK2(2872)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Jonathan B Bell et al.
Molecular cancer research : MCR, 16(1), 32-46 (2017-10-19)
Mesenchymal (MES) and proneural (PN) are two distinct glioma stem cell (GSC) populations that drive therapeutic resistance in glioblastoma (GBM). We screened a panel of 650 small molecules against patient-derived GBM cells to discover compounds targeting specific GBM subtypes. Arsenic...
Zhihua Guo et al.
Scientific reports, 7(1), 10612-10612 (2017-09-08)
We hypothesized that MAP kinase-interacting serine/threonine kinase 2 (MNK2) may contribute to non-small cell lung cancer (NSCLC) development, and serve as a new therapeutic target. Immunohistochemical staining evaluated the correlation between MNK2 expression and clinicopathological features in 367 NSCLC cancer...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.