EHU094261

Sigma-Aldrich

MISSION® esiRNA

targeting human DUOX1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAAGGATGGCAATGGCTACCTGTCCTTCCGAGAGTTCCTGGACATCCTGGTGGTCTTCATGAAAGGCTCTCCTGAGGAAAAGTCTCGCCTTATGTTCCGCATGTACGACTTTGATGGGAATGGCCTCATTTCCAAGGATGAGTTCATCAGGATGCTGAGATCCTTCATCGAGATCTCCAACAACTGCCTGTCCAAGGCCCAGCTGGCTGAGGTGGTGGAGTCCATGTTCCGGGAGTCGGGATTCCAGGACAAGGAGGAACTGACATGGGAAGATTTTCACTTCATGCTGCGGGACCACAATAGCGAGCTCCGCTTCACGCAGCTCTGTGTCAAAGGGGTGGAGGTGCCTGAAGTCATCAAGGACCTCTGCCGGCGAGCCTCCTACATCAGCCAGGATATGATCTGTCCCTCTCCCAGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DUOX1(53905), DUOX1(50506)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Sergio Candel et al.
PLoS biology, 12(5), e1001855-e1001855 (2014-05-08)
TNFα overexpression has been associated with several chronic inflammatory diseases, including psoriasis, lichen planus, rheumatoid arthritis, and inflammatory bowel disease. Paradoxically, numerous studies have reported new-onset psoriasis and lichen planus following TNFα antagonist therapy. Here, we show that genetic inhibition...
Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have...
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.