EHU096271

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB4A (1)

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGGAAATGCAGGAACTGGCAAATCTTGCTTACTTCATCAGTTTATTGAAAAAAAATTCAAAGATGACTCAAATCATACAATAGGAGTGGAATTTGGTTCAAAGATAATAAATGTTGGTGGTAAATATGTAAAGTTACAAATATGGGATACAGCAGGACAAGAACGATTCAGGTCCGTGACGAGAAGTTATTACCGAGGCGCGGCCGGGGCTCTCCTCGTCTATGATATCACCAGCCGAGAAACCTACAATGCGCTTACTAATTGGTTAACAGATGCCCGAATGCTAGCGAGCCAGAACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAB4A(5867), RAB4A(10638)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Tom Flossmann et al.
Cell reports, 26(12), 3173-3182 (2019-03-21)
Synchronized activity is a universal characteristic of immature neural circuits that is essential for their developmental refinement and strongly depends on GABAergic neurotransmission. A major subpopulation of GABA-releasing interneurons (INs) expresses somatostatin (SOM) and proved critical for rhythm generation in...
Arthur H Cheng et al.
Cell reports, 26(12), 3191-3202 (2019-03-21)
Clock neurons within the mammalian suprachiasmatic nuclei (SCN) encode circadian time using interlocked transcription-translation feedback loops (TTFLs) that drive rhythmic gene expression. However, the contributions of other transcription factors outside of the circadian TTFLs to the functionality of the SCN...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.