EHU099201

Sigma-Aldrich

MISSION® esiRNA

targeting human EDA2R

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCTCGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCAATGTGCCTTCCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EDA2R(60401), EDA2R(60401)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Mi Hee Kwack et al.
Biochemical and biophysical research communications, 529(3), 766-772 (2020-08-02)
Androgenetic alopecia (AGA) is a common genetic disorder, and a X-chromosomal locus that contains the androgen receptor (AR) and ectodysplasin A2 receptor (EDA2R) genes represents a major susceptibility locus for AGA. In our previous study, we reported that ectodysplasin-A2 (EDA-A2)...
Margherita Sisto et al.
Clinical and experimental medicine, 17(1), 111-119 (2015-12-15)
Despite recent advancements in the knowledge of the etiology and pathogenic mechanisms, treatment of the autoimmune disease Sjögren's syndrome (SS) remains mostly empiric and symptom-based, indicating the need for novel therapeutic approaches. Ectodysplasin-A2 (EDA-A2) is a recently isolated member of...
Xiqian Lan et al.
Biochimie, 174, 74-83 (2020-04-19)
EDA2R is a member of the large family of tumor necrosis factor receptor (TNFR). Previous studies suggested that EDA2R expression might be increased in the kidneys of diabetic mice. However, its mRNA and protein expression in kidneys were not analyzed;...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.