EHU100561

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC7A

Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCACCCAGCCTAGAATCTTGTATAATATGTAATTGTAGGGAAACTGCTCTCATAGGAAAGTTTTCTGCTTTTTAAATACAAAAATACATAAAAATACATAAAATCTGATGATGAATATAAAAAAGTAACCAACCTCATTGGAACAAGTATTAACATTTTGGAATATGTTTTATTAGTTTTGTGATGTACTGTTTTACAATTTTTACCATTTTTTTCAGTAATTACTGTAAAATGGTATTATTGGAATGAAACTATATTTCCTCATGTGCTGATTTGTCTTATTTTTTTCATACTTTCCCACTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CLEC7A(64581), CLEC7A(64581)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Nobuaki Fujiwara et al.
Cancer gene therapy, 26(1-2), 32-40 (2018-07-05)
Antisense oligonucleotides (AS-ODNs) hybridize with specific mRNAs, resulting in interference with the splicing mechanism or the regulation of protein translation. We previously demonstrated that the β-glucan schizophyllan (SPG) can form a complex with AS-ODNs with attached dA40 (AS-ODNs/SPG), and this...
Kelan Yuan et al.
International immunopharmacology, 52, 168-175 (2017-09-20)
To investigate the role of phosphorylated JNK in Dectin-1-induced IL-1β production and the role of Dectin-1 in apoptosis in mouse Aspergillus fumigatus (A. fumigatus) keratitis. Mice corneas were pretreated with Dectin-1 siRNA or SP600125 (the inhibitor of JNK) before A....
Cheng-Ye Che et al.
International journal of ophthalmology, 11(6), 905-909 (2018-07-07)
To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of...
Esther Weiss et al.
Frontiers in cellular and infection microbiology, 8, 288-288 (2018-09-05)
Invasive aspergillosis (IA) is an infectious disease caused by the fungal pathogen Aspergillus fumigatus that mainly affects immunocompromised hosts. To investigate immune cell cross-talk during infection with A. fumigatus, we co-cultured natural killer (NK) cells and dendritic cells (DC) after...
Xia Hua et al.
PloS one, 10(6), e0128039-e0128039 (2015-06-04)
Fungal infections of the cornea can be sight-threatening and have a worse prognosis than other types of microbial corneal infections. Peptidoglycan recognition proteins (PGLYRP), which are expressed on the ocular surface, play an important role in the immune response against...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.