EHU112941

Sigma-Aldrich

MISSION® esiRNA

targeting human ATRX

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGAAGAAGTGGGCTGAAGAATTTAATGATGAAACTAATGTGAGAGGACGATTATTTATCATTTCTACTAAAGCAGGATCTCTAGGAATTAATCTGGTAGCTGCTAATCGAGTAATTATATTCGACGCTTCTTGGAATCCATCTTATGACATCCAGAGTATATTCAGAGTTTATCGCTTTGGACAAACTAAGCCTGTTTATGTATATAGGTTCTTAGCTCAGGGAACCATGGAAGATAAGATTTATGATCGGCAAGTAACTAAGCAGTCACTGTCTTTTCGAGTTGTTGATCAGCAGCAGGTGGAGCGTCATTTTACTATGAATGAGCTTACTGAACTTTATACTTTTGAGCCAGACTTATTAGATGACCCTAATTCAGAAAAGAAGAAGAAGAGGGATACTCCCATGCTGCCAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATRX(546), ATRX(546)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Jaewon Min et al.
Nucleic acids research, 45(5), 2615-2628 (2017-01-14)
Alternative lengthening of telomeres (ALT) is a telomerase independent telomere maintenance mechanism that occurs in ∼15% of cancers. The potential mechanism of ALT is homology-directed telomere synthesis, but molecular mechanisms of how ALT maintains telomere length in human cancer is...
Manav Pathania et al.
Cancer cell, 32(5), 684-700 (2017-11-07)
Gain-of-function mutations in histone 3 (H3) variants are found in a substantial proportion of pediatric high-grade gliomas (pHGG), often in association with TP53 loss and platelet-derived growth factor receptor alpha (PDGFRA) amplification. Here, we describe a somatic mouse model wherein...
Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can...
Jinquan Cai et al.
Oncotarget, 6(20), 18105-18115 (2015-05-15)
Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.