EHU124231

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RUNX1(861), RUNX1(861)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
RUNX1 regulates TGF-? induced migration and EMT in colorectal cancer.
Lu, et al.
Pathology Research and Practice, 216, 153142-153142 (2020)
AHyun Choi et al.
Blood, 130(15), 1722-1733 (2017-08-10)
The gene encoding the RUNX1 transcription factor is mutated in a subset of T-cell acute lymphoblastic leukemia (T-ALL) patients, and RUNX1 mutations are associated with a poor prognosis. These mutations cluster in the DNA-binding Runt domain and are thought to...
Siyuan Zhou et al.
Biochemical and biophysical research communications, 519(3), 620-625 (2019-09-22)
Renal tubular epithelial cells (RTECs) play pivotal roles in the innate immune response in kidneys. Dendritic cell specific intracellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN) functions as both the innate immune recognition receptor and the adhesion molecule. In our previous study...
Wenjing Lang et al.
Experimental cell research, 374(1), 140-151 (2018-11-26)
High expression of the oncogene ecotropic viral integration site-1 (EVI-1) is an independent negative prognostic indicator of survival in leukemia patients. This study aimed to examine the effects of arsenic trioxide (ATO) on EVI-1 in acute myeloid leukemia (AML). Mononuclear...
Guangfen Mao et al.
Circulation, 136(10), 927-939 (2017-07-06)
PCTP (phosphatidylcholine transfer protein) regulates the intermembrane transfer of phosphatidylcholine. Higher platelet PCTP expression is associated with increased platelet responses on activation of protease-activated receptor 4 thrombin receptors noted in black subjects compared with white subjects. Little is known about...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.