EHU126851

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR5

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCR5(1234), CCR5(1234)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Sandra Zazo et al.
Molecular cancer therapeutics, 19(8), 1696-1707 (2020-05-15)
HER2-positive breast cancer is currently managed with chemotherapy in combination with specific anti-HER2 therapies, including trastuzumab. However, a high percentage of patients with HER2-positive tumors do not respond to trastuzumab (primary resistance) or either recur (acquired resistance), mostly due to...
Silvia Waldeck et al.
Molecular oncology, 14(4), 779-794 (2020-01-20)
FLT3-ITD tyrosine kinase inhibitors (TKI) show limited clinical activity in acute myeloid leukemia (AML) due to emerging resistance. TKI resistance is mediated by secondary FLT3-ITD mutations only in a minority of cases. We hypothesize that the cytokine CCL5 protects AML...
Ji Hoon Phi et al.
PloS one, 12(1), e0169714-e0169714 (2017-01-11)
The etiology and pathogenesis of moyamoya disease (MMD) are still obscure. Previous studies indicated that angiogenic chemokines may play an important role in the pathogenesis of the disease. Recently, it was discovered that peripheral blood-derived endothelial colony-forming cells (ECFCs) and...
Shen Pang et al.
PloS one, 9(5), e96445-e96445 (2014-05-17)
The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression....
Ying Wang et al.
Oncology reports, 36(6), 3522-3528 (2016-10-18)
Glioblastoma (GBM) is a highly malignant brain tumor characterized by invasion tendency. Macrophage infiltration is associated with GBM invasion, but the mechanisms remain unclear. Hypoxia is an outstanding characteristic of GBM tissue. Hypoxia microenvironment modulates the biological behaviors of both tumor...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.