EHU130861

Sigma-Aldrich

MISSION® esiRNA

targeting human LRWD1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGTCAGGATTGGAGCTGCTTTCCGAGCACCTGGACCCCAAACTCCTGTGCCGCCTGACGCAGCTGCAGGAGCTTGACCTGTCTAACAACCACCTGGAGACGCTGCCGGACAACCTGGGCCTGTCCCACCTGCGTGTCCTCCGCTGCGCCAACAACCAGCTGGGGGATGTTACTGCCTTGTGCCAGTTCCCCAAGCTCGAGGAACTCAGCCTGGAGGGCAACCCCTTCCTGACGGTCAATGACAACCTGAAAGTCTCCTTTCTCCTGCCCACGCTCCGTAAGGTCAATGGCAAGGATGCGTCCTCAACTTACTCTCAGGTGGAGAACCTGAATCGGGAGCTGACCAGCAGGGTCACAGCTCACTGGGAGAAGTTCATGGCCACACTGGGTCCTGAAGAGGAGGCTGAGAAGGCCCAGGCGGACTTTGTGAAGTCGGCTGTCAGGGATGTCCGCTACGGGCCCGAGTCCCTCAGCGAGTTCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LRWD1(222229), LRWD1(222229)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Julien Brustel et al.
The EMBO journal, 36(18), 2726-2741 (2017-08-06)
Among other targets, the protein lysine methyltransferase PR-Set7 induces histone H4 lysine 20 monomethylation (H4K20me1), which is the substrate for further methylation by the Suv4-20h methyltransferase. Although these enzymes have been implicated in control of replication origins, the specific contribution...
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.