EHU136691

Sigma-Aldrich

MISSION® esiRNA

targeting human SRPX2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCACTGTGATGGCGGTTATGATCGCCAGGGGACACCCTCCCGGGTCTGTCAGTCCAGCCGCCAGTGGTCAGGTTCACCACCAATCTGTGCTCCTATGAAGATTAACGTCAACGTCAACTCAGCTGCTGGTCTCTTGGATCAATTCTATGAGAAACAGCGACTCCTCATCATCTCAGCTCCTGATCCTTCCAACCGATATTATAAAATGCAGATCTCTATGCTACAGCAATCCACCTGTGGACTGGATTTGCGGCATGTGACCATCATTGAACTGGTGGGACAGCCACCTCAGGAGGTGGGGCGCATCCGGGAGCAACAGCTGTCAGCCAACATCATCGAGGAGCTCAGGCAATTTCAGCGCCTCACTCGCTCCTACTTCAACATGGTGTTGATTGACAAGCAGGGTATTGACCGAGACCGCTACATGGAACCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SRPX2(27286), SRPX2(27286)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Xin Hong et al.
Journal of biochemical and molecular toxicology, e22237-e22237 (2018-12-12)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is reported to play a critical role in tumorigenesis. However, the expression and functional role of SRPX2 in prostate cancer have not been defined. Thus, the aim of this...
Xiaobo Lin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 93, 398-405 (2017-06-28)
Sushi repeat-containing protein X-linked 2 (SRPX2), a novel chondroitin sulfate proteoglycan, is overexpressed in human cancer. Recent studies have reported that SRPX2 overexpression is observed in gastrointestinal cancer, and promotes migration and invasion of cancer cells. While, the clinical significance...
Xiujuan Li et al.
Acta biochimica Polonica, 67(2), 165-172 (2020-06-19)
Recent studies showed that sushi repeat containing protein X linked 2 (SRPX2) could participate in the development of various malignant tumors. However, its role in non-small cell lung cancer (NSCLC) was unknown. The aim of the study was to prospectively...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.