EHU138031

Sigma-Aldrich

MISSION® esiRNA

targeting human ICAM1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ICAM1(3383), ICAM1(3383)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central...
Dejun Xu et al.
Biological chemistry, 401(5), 601-615 (2019-12-22)
Long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been identified as a regulatory molecule in angiogenesis. The goal of this study was to illustrate how MEG3 affects the angiogenesis of vascular endothelial cells. Expression of MEG3, miR-147 and...
Wei Gu et al.
Oncotarget, 8(67), 111882-111901 (2018-01-18)
Intercellular adhesion molecule-1 is the adhesion molecule mediating leukocyte firm adhesion to endothelial cells, plays a critical role in subsequent leukocyte transmigration. ICAM-1 is also expressed in other cells including macrophages; however, the role of this adhesion molecule in mediating...
Hannah L Wiesolek et al.
The American journal of pathology, 190(4), 874-885 (2020-02-09)
Intercellular adhesion molecule-1 (ICAM-1) is up-regulated during inflammation by several cell types. ICAM-1 is best known for its role in mediating leukocyte adhesion to endothelial cells and guiding leukocytes across the vascular wall. Recently, macrophages have been shown to express...
Meiping Yan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 4759-4769 (2017-07-14)
Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.