EHU140561

Sigma-Aldrich

MISSION® esiRNA

targeting human IL6R

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGTGCCTTCCTCTTTTTATTTAGTTCCTTGAGTTGATTCAGCTCTGCAAGAATTGAAGCAGGACTAAATGTCTAGTTGTAACACCATGATTAACCACTTCAGCTGACTTTTCTGTCCGAGCTTTGAAAATTCAGTGGTGTTAGTGGTTACCCAGTTAGCTCTCAAGTTATCAGGGTATTCCAGAGTGGGGATATGATTTAAATCAGCCGTGTAACCATGGACCCAATATTTACCAGACCACAAAACTTTTCTAATACTCTACCCTCTTAGAAAAACCACCACCATCACCAGACAGGTGCGAAAGGATGAAAGTGACCATGTTTTGTTTACGGTTTTCCAGGTTTAAGCTGTTACTGTCTTCAGTAAGCCGTGATTTTCATTGCTGGGCTTGTCTGTAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IL6R(3570), IL6R(3570)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Wen Deng et al.
International journal of stem cells, 13(1), 142-150 (2020-01-01)
Mesenchymal stem cells (MSCs) have the multipotent capacity to differentiate into multiple tissue lineages as well as to self-renew, which is the main origin of adipocytes. IL6/IL6R pathway exerts a significant role in tissue regeneration and cell differentiation. Whereas, the...
Xusheng Ding et al.
Cell death & disease, 9(9), 867-867 (2018-08-31)
Cancer-associated fibroblasts (CAFs) are important components of tumor stroma and play a key role in tumor progression. CAFs involve in crosstalk with tumor cells through various kinds of cytokines. In the present study, we screened hepatocyte growth factor (HGF) as...
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.