EHU142711

Sigma-Aldrich

MISSION® esiRNA

targeting human TNKS

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGAACACCTTCGGGATATCTTTGAAACAGAACAGATTACACTAGATGTGTTGGCTGATATGGGTCATGAAGAGTTGAAAGAAATAGGCATCAATGCATATGGGCACCGCCACAAATTAATCAAAGGAGTAGAAAGACTCTTAGGTGGACAACAAGGCACCAATCCTTATTTGACTTTTCACTGTGTTAATCAGGGAACGATTTTGCTGGATCTTGCTCCAGAAGATAAAGAATATCAGTCAGTGGAAGAAGAGATGCAAAGTACTATTCGAGAACACAGAGATGGTGGTAATGCTGGCGGCATCTTCAACAGATACAATGTCATTCGAATTCAAAAAGTTGTCAACAAGAAGTTGAGGGAGCGGTTCTGCCACCGACAGAAGGAAGTGTCTGAGGAGAATCACAACCATCACAATGAGCGCATGTTGTTTCATGGTTCTCCTTTCATTAATGCCATTATTCATAAAGGGTTTGATGAGCGACATGCATACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TNKS(8658), TNKS(8658)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Harmonie Perdreau-Dahl et al.
Communications biology, 3(1), 123-123 (2020-03-15)
Sjögren syndrome/scleroderma autoantigen 1 (SSSCA1) was first described as an auto-antigen over-expressed in Sjögren's syndrome and in scleroderma patients. SSSCA1 has been linked to mitosis and centromere association and as a potential marker candidate in diverse solid cancers. Here we...
Nan Li et al.
Nature communications, 10(1), 4363-4363 (2019-09-27)
The LKB1/AMPK pathway plays a major role in cellular homeostasis and tumor suppression. Down-regulation of LKB1/AMPK occurs in several human cancers and has been implicated in metabolic diseases. However, the precise upstream regulation of LKB1-AMPK pathway is largely unknown. Here, we...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.