EHU142761

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2A

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGACCACGTATCCCACTTGGAGAATGTGTCAGAGGATGAGATAAACCGACTGCTGGGGATGGTGGTGGATGTGGAGAATCTCTTCATGTCTGTTCACAAGGAAGAGGACACAGACACCAAGCAGGTCTATTTCTACCTCTTCAAGCTACTGCGGAAATGCATCCTGCAGATGACCCGGCCTGTGGTGGAGGGGTCCCTGGGCAGCCCTCCATTTGAGAAACCTAATATTGAGCAGGGTGTGCTGAACTTTGTGCAGTACAAGTTTAGTCACCTGGCTCCCCGGGAGCGGCAGACGATGTTCGAGCTCTCAAAGATGTTCTTGCTCTGCCTTAACTACTGGAAGCTTGAGACACCTGCCCAGTTTCGGCAGAGGTCTCAGGCTGAGGACGTGGCTACCTACAAGGTCAATTACACCAGATGGCTCTGTTACTGCCACGTGCCCCAGAGCTGTGATAGCCTCCCCCGCTACGAAACCACTCATGTCTTTGGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KAT2A(2648), KAT2A(2648)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Liming Zhao et al.
Oncology letters, 16(3), 3955-3963 (2018-08-22)
Histone acetyltransferase GCN5 is a critical component of the TGF-β/Smad signaling pathway in breast cancer cells; however, it remains unknown whether it is involved in the development and progression of breast cancer. The present study investigated the role of GCN5...
Lijun Qiao et al.
Journal of cellular and molecular medicine, 22(11), 5333-5345 (2018-08-07)
General control nondepressible 5 (GCN5), the first identified transcription-related lysine acetyltransferase (KAT), is an important catalytic component of a transcriptional regulatory SAGA (Spt-Ada-GCN5-Acetyltransferase) and ATAC (ADA2A-containing) complex. While GCN5 has been implicated in cancer development, its role in cervical cancer...
Kun Liu et al.
International journal of molecular sciences, 16(9), 21897-21910 (2015-09-18)
The general control of nucleotide synthesis 5 (GCN5), which is one kind of lysine acetyltransferases, regulates a number of cellular processes, such as cell proliferation, differentiation, cell cycle and DNA damage repair. However, its biological role in human glioma development...
Changhan Ouyang et al.
Autophagy, 16(10), 1753-1770 (2019-12-28)
Macroautophagy/autophagy, a fundamental process for degradation of macromolecules and organelles, occurs constitutively at a basal level and is upregulated in response to stress. Whether autophagy regulates protein acetylation and microtubule stability in vascular smooth muscle cells (VSMCs) migration, however, remains...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.