EHU144411

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTAAGCTGGGTGAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCACTACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTCCTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACAGACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCCACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAGAAGTGAACGCGACCCCCCTCCCTCTCACTCCTCTTGCCCTCTGCTTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARF1(375), ARF1(375)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO...
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde...
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)...
Protocols
Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.
Read More

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.