EHU144651

Sigma-Aldrich

MISSION® esiRNA

targeting human SDHB

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACTCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCTTCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGCCTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGCAGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCACAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SDHB(6390), SDHB(6390)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Yi Li et al.
Free radical biology & medicine, 126, 1-14 (2018-07-22)
In response to hypoxic succinate accumulates in arthritis synovium, however, the implication is little known. This study aims to investigate whether succinate could act as a metabolic signal linking metabolic alternation with angiogenesis in arthritis synovium. The interaction between elevated...
Sascha Rahn et al.
Cancers, 12(1) (2019-12-28)
Pancreatic ductal adenocarcinoma (PDAC) is amongst the most fatal malignancies and its development is highly associated with inflammatory processes such as chronic pancreatitis (CP). Since the succinate dehydrogenase subunit B (SDHB) is regarded as tumor suppressor that is lost during...
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.