EHU145511

Sigma-Aldrich

MISSION® esiRNA

targeting human STAG2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTATGCAGTCGGTGGTAGATGATTGGATAGAATCATACAAGCATGACCGAGATATAGCACTTCTTGACCTTATCAACTTTTTTATTCAGTGTTCAGGCTGTAAAGGAGTTGTCACAGCAGAAATGTTTAGACATATGCAGAACTCTGAGATAATTCGAAAAATGACTGAAGAATTCGATGAGGATAGTGGAGATTATCCACTTACCATGGCTGGTCCTCAGTGGAAGAAGTTCAAATCCAGTTTTTGTGAATTCATTGGCGTGTTAGTACGGCAATGTCAATATAGTATCATATATGATGAGTATATGATGGATACAGTCATTTCACTTCTTACAGGATTGTCTGACTCACAAGTCAGAGCATTTCGACATACAAGCACCCTGGCAGCTATGAAGTTGATGACAGCTTTGGTGAATGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STAG2(10735), STAG2(10735)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Gourish Mondal et al.
Nature communications, 10(1), 1686-1686 (2019-04-13)
Cohesin is a multiprotein ring that is responsible for cohesion of sister chromatids and formation of DNA loops to regulate gene expression. Genomic analyses have identified that the cohesin subunit STAG2 is frequently inactivated by mutations in cancer. However, the...
Yi Chen et al.
Molecular oncology, 14(5), 1101-1117 (2020-03-03)
Ewing sarcomas (ESs) are aggressive sarcomas driven by EWS fusion genes. We sought to investigate whether whole-transcriptome sequencing (RNA-seq) could be used to detect patterns associated with chemotherapy response or tumor progression after first-line treatment. Transcriptome sequencing (RNA-seq) of 13...
Marianna Kleyman et al.
Journal of cell science, 127(Pt 19), 4225-4233 (2014-07-31)
Mutations in the STAG2 gene are present in ∼20% of tumors from different tissues of origin. STAG2 encodes a subunit of the cohesin complex, and tumors with loss-of-function mutations are usually aneuploid and display elevated frequencies of lagging chromosomes during...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.