EHU146001

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX7

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCGTCCCAAATACAGTTTCCGTCGCCTTGACGACAAGACCACCAACGTGTCCTTGTACCCTGGCTACAACTTCAGATACGCCAAGTACTACAAGGAAAACAATGTTGAGAAACGGACTCTGATAAAAGTCTTCGGGATCCGTTTTGACATCCTGGTTTTTGGCACCGGAGGAAAATTTGACATTATCCAGCTGGTTGTGTACATCGGCTCAACCCTCTCCTACTTCGGTCTGGCCGCTGTGTTCATCGACTTCCTCATCGACACTTACTCCAGTAACTGCTGTCGCTCCCATATTTATCCCTGGTGCAAGTGCTGTCAGCCCTGTGTGGTCAACGAATACTACTACAGGAAGAAGTGCGAGTCCATTGTGGAGCCAAAGCCGACATTAAAGTATGTGTCCTTTGTGGATGAATCCCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... P2RX7(5027), P2RX7(5027)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Bin Leng et al.
Oxidative medicine and cellular longevity, 2020, 5070415-5070415 (2020-10-06)
Vascular endothelial dysfunction is associated with increased mortality in patients with diabetes. Astragaloside IV (As-IV) is a bioactive saponin with therapeutic potential as an anti-inflammatory and antiendothelial dysfunction. However, the underlying mechanism for how As-IV ameliorated endothelial dysfunction is still...
Miso Park et al.
Scientific reports, 9(1), 11587-11587 (2019-08-14)
Tamoxifen (TAM) is the standard anti-hormonal therapy for estrogen receptor-positive breast cancer. However, long-term TAM therapy can make acquisition of TAM resistance and there are still no solutions to treat TAM-resistant breast cancer. In this study, we found that protein...
Hui Pan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13533-13543 (2016-07-30)
Uveal melanoma (UM) has a high mortality rate for primary intraocular tumors. Approximately half of UM patients present with untreatable and fatal metastases. Long non-coding RNAs (lncRNAs) have emerged as potent regulatory RNAs that play key roles in various cellular...
Hengli Zhao et al.
Scientific reports, 6, 23286-23286 (2016-03-17)
Blockading P2X7 receptor(P2X7R) provides neuroprotection toward various neurological disorders, including stroke, traumatic brain injury, and subarachnoid hemorrhage. However, whether and how P2X7 receptor suppression protects blood-brain barrier(BBB) after intracerebral hemorrhage(ICH) remains unexplored. In present study, intrastriatal autologous-blood injection was used...
Wang Lili et al.
Experimental biology and medicine (Maywood, N.J.), 244(9), 734-742 (2019-05-02)
The mechanism of gastric cancer is highly complex, accompanied by a variety of genetic abnormalities. It is of great significance to elucidate the pathogenesis of gastric cancer, find its markers and therapeutic targets in the fight against this fatal disease....

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.