EHU148311

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA1A (2)

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATCTCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCAAGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTTTTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HSPA1A(3303), HSPA1A(3303)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Chungen Yan et al.
International journal of clinical and experimental medicine, 8(4), 5746-5752 (2015-07-02)
To explore the ultrasound-guided gene transfection as well as the role of heat shock protein 72 (HSP72) siRNA combined with ultrasound micro-bubble contrast agents on rat hepatic ischemia-reperfusion injury. 72 SD rats were divided into non-surgery group (group N), sham-operation...
Salvador Mena et al.
PloS one, 7(9), e44524-e44524 (2012-09-08)
The phenolic phytoalexin resveratrol is well known for its health-promoting and anticancer properties. Its potential benefits are, however, limited due to its low bioavailability. Pterostilbene, a natural dimethoxylated analog of resveratrol, presents higher anticancer activity than resveratrol. The mechanisms by...
Taek-Keun Kim et al.
Biochemical and biophysical research communications, 469(2), 222-228 (2015-12-15)
Heat shock protein 70-1A (HSP70-1A) is a stress-inducible protein that provides an essential intracellular molecular chaperone function; however, the mechanism of HSP70-1A in angiogenesis has not been clarified. Herein, HSP70-1A gene silencing implicated this protein in angiogenesis. Additionally, recombinant human...
Ilse M Beck et al.
PloS one, 8(7), e69115-e69115 (2013-08-13)
Compound A possesses glucocorticoid receptor (GR)-dependent anti-inflammatory properties. Just like classical GR ligands, Compound A can repress NF-κB-mediated gene expression. However, the monomeric Compound A-activated GR is unable to trigger glucocorticoid response element-regulated gene expression. The heat shock response potently...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.