EHU150631

Sigma-Aldrich

MISSION® esiRNA

targeting human ADIPOQ, ADIPOQ-AS1

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACATGCCCATTCGCTTTACCAAGATCTTCTACAATCAGCAAAACCACTATGATGGCTCCACTGGTAAATTCCACTGCAACATTCCTGGGCTGTACTACTTTGCCTACCACATCACAGTCTATATGAAGGATGTGAAGGTCAGCCTCTTCAAGAAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCTGTGCTCCTGCATCTGGAGGTGGGCGACCAAGTCTGGCTCCAGGTGTATGGGGAAGGAGAGCGTAATGGACTCTATGCTGATAATGACAATGACTCCACCTTCACAGGCTTTCTTCTCTACCATGACACCAACTGATCACCACTAACTCAGAGCCTCCTCCAGGCCAAACAGCCCCAAAGTCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADIPOQ(9370), ADIPOQ(9370)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Yuu Okura et al.
International journal of molecular sciences, 20(7) (2019-04-03)
Both adiponectin and secreted protein, acidic and rich in cysteine (SPARC) inhibit platelet-derived growth factor-BB (PDGF-BB)-induced and basic fibroblast growth factor (FGF2)-induced angiogenic activities through direct and indirect interactions. Although SPARC enhances nerve growth factor (NGF)-dependent neurogenesis, the physical interaction...
Roberta G Marangoni et al.
Scientific reports, 7(1), 4397-4397 (2017-07-02)
Skin fibrosis in systemic sclerosis (SSc) is accompanied by attrition of dermal white adipose tissue (dWAT) and reduced levels of circulating adiponectin. Since adiponectin has potent regulatory effects on fibroblasts, we sought to assess adiponectin signaling in SSc skin biopsies...
Juhyun Song et al.
Cell death & disease, 8(10), e3102-e3102 (2017-10-13)
Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by excessive beta amyloid (Aβ) deposition in brain, leading to blood-brain barrier (BBB) disruption. The mechanisms of BBB disruption in AD are still unclear, despite considerable research. The adipokine adiponectin...
H-Q Tang et al.
European review for medical and pharmacological sciences, 24(14), 7645-7654 (2020-08-04)
To investigate the expression of Long non-coding RNA ADIPOQ and its facilitating effects on proliferation and invasion of colorectal cancer by modulating the expression of TP53 via sponging with miR-219c-3p. qRT-PCR was performed to detect the expressions of ADIPOQ and...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.