EHU153501

Sigma-Aldrich

MISSION® esiRNA

targeting human RHBDF2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTGTACGAGAGCGTGAAGTACATCCAGCAGGAGAACTTCTGGGTTGGCCCCAGCTCGATTGACCTGATCCACCTGGGGGCCAAGTTCTCACCCTGCATCCGGAAGGACGGGCAGATCGAGCAGCTGGTGCTGCGCGAGCGAGACCTGGAGCGGGACTCAGGCTGCTGTGTCCAGAATGACCACTCCGGATGCATCCAGACCCAGCGGAAGGACTGCTCGGAGACTTTGGCCACTTTTGTCAAGTGGCAGGATGACACTGGGCCCCCCATGGACAAGTCTGATCTGGGCCAGAAGCGGACTTCGGGGGCTGTCTGCCACCAGGACCCCAGGACCTGCGAGGAGCCAGCCTCCAGCGGTGCCCACATCTGGCCCGATGACATCACTAAGTGGCCGATCTGCACAGAGCAGGCCAGGAGCAACCACACAGGCTTCCTGCACATGGACTGCGAGATCAAGGGCCGCCCCTGCTGCATCGGCACCAAGGGCAGCTGTGAGATCACCACCCGGGAATACTGTGAGTTCATGCACGGCTATTTCCATGAGGAAGCAACACTCTGCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RHBDF2(79651), RHBDF2(79651)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Chen-Xu Ge et al.
Biochemical and biophysical research communications, 493(4), 1402-1409 (2017-10-03)
Accumulating researches reported that particulate matter (PM2.5) is a risk factor for developing various diseases, including metabolic syndrome. Recently, inactive rhomboid protein 2 (iRhom2) was considered as a necessary modulator for shedding of tumor necrosis factor-α (TNF-α) in immune cells....
Cheng Chaohui et al.
Biochemical and biophysical research communications, 503(3), 1897-1904 (2018-08-12)
Atherosclerosis is a complex chronic inflammatory disease that is characterized by the formation of lipid-rich plaques on the inner walls of the arteries. Inactive rhomboid protein 2 (iRhom2) was recently determined as a necessary regulator for the shedding of tumor...
Ulrike Künzel et al.
eLife, 7 (2018-06-14)
Many intercellular signals are synthesised as transmembrane precursors that are released by proteolytic cleavage ('shedding') from the cell surface. ADAM17, a membrane-tethered metalloprotease, is the primary shedding enzyme responsible for the release of the inflammatory cytokine TNFα and several EGF...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

Merck

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.