Skip to Content
Merck
Search Within
Document Type

Showing 1-30 of 37480 results
Supel -Tips Pipette Tips for Micro-Purification/Enrichment
Supel-Tips Supel ™ -Tips Pipette Tips for Micro-Purification/Enrichment Solutions for • Proteomics • Glycomics • Metabolomics and more...
CHICKEN ANTI- GHRELIN, ACTIVE
Microsoft Word - AB9756.doc 28820 Single Oak Drive • Temecula, CA 92590 Technical Support: T: 1-800-MILLIPORE (1-800-645-5476) •
Data Sheet - G0541
Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert N1) (G0541) - Data Sheet Anti-Glutamate Receptor NMDAR1 (NR1) (Splice Variant Insert N1) produced in rabbit, affinity isolated antibody Catalog Number G0541 Product Description Anti-Glutamate Receptor NMDAR1
Mycoplasma Retention Testing for 0.1 μm Sterilizing-Grade Filters
Service ProceSS DeScriPtion Retention testing is required to validate retention of sterilizing-grade membrane filters with specific pharmaceutical preparations. Millipore’s Validation Sciences Laboratories conduct testing on a lab-scale using scaled- down processing conditions such as
Data Sheet - P8155 - Lot 111K8814
P8155-111K8814.doc PHENYLEPHRINE HYDROCHLORIDE SIGMA REFERENCE STANDARD Product No. P8155 Lot No: 111K8814 Storage Temperature: Room Temperature Formula:
Data Sheet - A3476
Anti-ADAM-19, Propeptide Domain antibody produced in rabbit (A3476) - Datasheet Anti-ADAM-19, Propeptide Domain Developed in Rabbit Affinity Isolated Antibody Product Number A 3476
Antibiotics - C3050
Antibiotics ProductInformation Antibiotics The following table is designed as a guide for selecting appropriate antibiotics and working concentrations. Care should be exercised when using 2 or more antibiotics in the same culture system. Combined antibiotics frequently exert
Product Information Sheet - L5385
a-Lactalbumin from bovine milk (L5385) - Product Information Sheet αααα-Lactalbumin from bovine milk Product Number L 5385 Storage Temperature -0 °C Product Description CAS Number: 9051-29-0 Molecular
Bulletin - ARLV1000
Vortamix Mini Vortexer Operator’s Manual Manuel de l’opérateur Bedienungshandbuch Manual del operador Manuale d’uso オペレーターマニュアル Argos Technologies, Inc. 1551 South Scottsdale Court Suite 200 Elgin, IL 60123 Toll Free: 800-886-8675 International: 847-622-0456 www.argos-tech.com manufacturing solutions for science
Product Information Sheet - LUCASSYRO
11669893001a.fm Luciferase Reporter Gene Assay, high sensitivity y Version 20 Content version: March 2016 Chemiluminescent assay for the quantitative determination of firefly lucifer- ase activity in transfected cells Cat. No. 11 669 893
Data Sheet - GW21034
Anti-Interleukin-21 (GW21034) - Datasheet Anti-Interleukin-21 antibody produced in chicken, affinity isolated antibody Catalog Number GW21034 Formerly listed as GenWay Catalog Number 15-288-21034, Interleukin-21 Antibody. Storage Temperature Store at –20 °C Synonyms: Interleukin 21, IL-21; Za11
Culture Boxes
Magenta� vessel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 each 100 each V 8505 GA-7
Data Sheet - SAB4200400
Anti-WIPI-2 (C-terminal) (SAB4200400) - Data Sheet Anti-WIPI-2 (C-terminal) produced in rabbit, affinity isolated antibody Catalog Number SAB4200400 Product Description Anti-WIPI-2 (C-terminal) is produced in rabbit using as immunogen a synthetic peptide corresponding to the
Data Sheet - 70182
Antibiotic Agar No 2 (Penassay Base Agar; Grove and Randall Antibiotic Agar No. 2) 70182 Page 1 of 2
Data Sheet - F4766
F4766DAT.doc MONOCLONAL ANTI-CHICKEN LIGHT CHAINS FITC CONJUGATE CLONE CH-31 Immunoglobulin Fraction of Mouse Ascites Fluid Product No. F 4766 Product Description Monoclonal Anti-Chicken Light Chains (mouse IgG1 isotype) is derived
DOZN Scorecards for Sigma Aldrich
32017 - DOZN Scorecards for sigmaaldrich.com-MRK THE DOZN™ SCALE Based on the 12 Principles of Green Chemistry*, DOZN helps researchers, scientists, and manufacturers increase performance and efficiency while reducing human and environmental impact. *Paul
Data Sheet - F2879 - Lot 017H8975
Anti-Human IgA (a-chain specific)—FITC antibody produced in goat (F2879) - Lot#: 017H8975 - Datasheet Product No. F-2879 Lot 017H8975 Anti-Human IgA ( ��-chain specific) FITC Conjugate Antibody developed in
LPP Hu-Cy5 SmartFlare™ RNA Detection Probe
Background SPECIES LEGEND: Hu Human Ms Mouse Rt Rat Rb Rabbit WR Most Common Vertebrates ( ) Predicted Reactivity Please visit www.millipore.com/SmartFlare
Data Sheet - 78996
Please fill in the request form and tell us your wishes 78996 HiFluoro™ Pseudomonas Agar Base (Pseudomonas Agar Base HiFluoro) Hifluoro Pseudomonas Agar Base is used as a selective medium for
BTK Active (B4312)
BTK, Active (B4312) - Datasheet BTK, Active human, recombinant His-tagged, expressed in Sf9 cells Catalog Number B4312 Lot Number 019K1563 Storage Temperature –70 °C Synonyms: AT; ATK; BPK; XLA; IMD1; AGMX1; PSCTK Product Description BTK
HUMAN C-REACTIVE PROTEIN (CRP) PURIFIED PROTEIN
MOUSE ANTI-***** 28820 Single Oak Drive • Temecula, CA 92590 Technical Support: T: 1-800-MILLIPORE (1-800-645-5476) • F: 1-800-437-7502
Data Sheet - SAB4200346
Anti-SMAD7 (N-terminal) (SAB4200346) - Data Sheet Anti-SMAD7 (N-terminal) produced in rabbit, affinity isolated antibody Product Number SAB4200346 Product Description Anti-SMAD7 (N-terminal) is produced in rabbit using as immunogen a peptide corresponding to the N-terminal
TB230 pET-39b Vector Map
pET-39b(+) TB230 10/98 CATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGTACTGCAATTGGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTGGGTACC ÓÓÓÓÓÓÍÅÌÒ◊∏ÂÌÍÊÅÈ̘‰ÊÅÅÅωŒӘÎÍ∏ÎÒÌÊ GATGACGACGACAAGAGCCCGGGCTTCTCCTCAACCATGGCGATATCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACCACCACTAA ÎÎÎÎÍ∏ÌÏÍÍʘÅÈÍÎ∏ˆÍÍÍ◊ÎÒÅÅÅÒ‰ÓÓÓÓÓÓÓÓEnd TTGATTAATACCTAGGCTGCTAAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG ATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGGCG...522bp...CAGCAGTATGCTGATACAGTGAAATACTTAAGCGAGAAAAAAGGATCAACTAGTGGTTCTGGT ˜È„ÒÅÒÅÌÒ◊ÒÅÏÍÅÍÅÅ...174aa...ŒŒÁÅÎÊ◊ÁÒ͉ÌÍÊÍÌÍÌ signal peptidase ATGCGTCCGGCGTAGAGGATCGAGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT Srf I BseR I
Data Sheet - L6516
Lymphotactin from mouse (L6516) - Datasheet LYMPHOTACTIN (LPTN) Mouse, Recombinant Expressed in Echerichia coli Product Number L 6516 Product Description Recombinant mouse Lymphotactin (Lptn) is
LIN28A Hu-Cy3 SmartFlare™ RNA Detection Probe
Background SPECIES LEGEND: Hu Human Ms Mouse Rt Rat Rb Rabbit WR Most Common Vertebrates ( ) Predicted Reactivity Please visit www.millipore.com/SmartFlare
Data Sheet - SRP5019
DCAMKL1, active (SRP5019) - Datasheet DCAMKL1, active, GST-tagged, human PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5019 Storage Temperature –70 °C Synonyms: DCLK1, DCDC3A, DCLK, KIAA0369 Product Description DCAMKL1 or doublecortin-like kinase
Data Sheet - SRP5226
PAD4 (SRP5226) - Datasheet PAD4, GST-tagged, human recombinant, expressed in Sf9 cells Catalog Number SRP5226 Storage Temperature –70 °C Synonyms: PADI4, PAD, PDI4, PDI5 Product Description PAD4 is a member of the peptidyl arginine
Data Sheet - C8290
Anti-Cat IgG (whole molecule) antibody produced in goat (C8290) - Datasheet ANTI-CAT IgG (WHOLE MOLECULE) Affinity Isolated Antigen Specific Antibody Product Number C 8290 Product Description The
Data Sheet - M0682
EX-CELL™ MDBK-MM Protein-free Medium (M0682) - Datasheet MEDIUM SYSTEM FOR MDBK CELLS Product Nos. M 3553 AND M 0682 Storage Temperature 2-8 °C Product Description The MDBK serum-free system
Protocol: Human Adiponectin RIA Kit
_________________ RIA KIT The M logo is a trademark of Merck KGaA, Darmstadt, Germany. © 2013 EMD Millipore Corporation, Billerica, MA 01821 USA. HADP-61HK Human Adiponectin 125 Tubes
Page 1 of 1250