All Photos(1)

EHU006651

Sigma-Aldrich

MISSION® esiRNA

targeting human CKM

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGGTAACACCCACAACAAGTTCAAGCTGAATTACAAGCCTGAGGAGGAGTACCCCGACCTCAGCAAACATAACAACCACATGGCCAAGGTACTGACCCTTGAACTCTACAAGAAGCTGCGGGACAAGGAGACTCCATCTGGCTTCACTGTAGACGATGTCATCCAGACAGGAGTGGACAACCCAGGTCACCCCTTCATCATGACCGTGGGCTGCGTGGCTGGTGATGAGGAGTCCTACGAAGTTTTCAAGGAACTCTTTGACCCCATCATCTCGGATCGCCACGGGGGCTACAAACCCACTGACAAGCACAAGACTGACCTCAACCATGAAAACCTCAAGGGTGGAGACGACCTGGACCCTAACTACGTGCTCAGCAGCCGCGTCCGCACTGGCCGCAGCATCAAGGGCTACACGTTGCCCCCACACTGCTCCCGTGGCGAGCGCCGGGCGGTGGAGAAGCTCTCTGTGGAAGCTCTCAACAGCCTGACGGGCGAGTTCAAAGGGAAGTACTACCCTCTGAAGAGCATGACGGAGAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Adriana Simionescu-Bankston et al.
American journal of physiology. Cell physiology, 308(11), C919-C931 (2015-03-27)
Myoblast fusion is critical for proper muscle growth and regeneration. During myoblast fusion, the localization of some molecules is spatially restricted; however, the exact reason for such localization is unknown. Creatine kinase B (CKB), which replenishes local ATP pools, localizes...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service