EHU014811

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP1B1

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCCTGGCCTTCCTTTATGAAGCCATGCGCTTCTCCAGCTTTGTGCCTGTCACTATTCCTCATGCCACCACTGCCAACACCTCTGTCTTGGGCTACCACATTCCCAAGGACACTGTGGTTTTTGTCAACCAGTGGTCTGTGAATCATGACCCAGTGAAGTGGCCTAACCCGGAGAACTTTGATCCAGCTCGATTCTTGGACAAGGATGGCCTCATCAACAAGGACCTGACCAGCAGAGTGATGATTTTTTCAGTGGGCAAAAGGCGGTGCATTGGCGAAGAACTTTCTAAGATGCAGCTTTTTCTCTTCATCTCCATCCTGGCTCACCAGTGCGATTTCAGGGCCAACCCAAATGAGCCTGCGAAAATGAATTTCAGTTATGGTCTAACCATTAAACCCAAGTCATTTAAAGTCAATGTCACTCTCAGAGAGTCCATGGAGCTCCTTGATAGTGCTGTCCAAAATTTACAAGCCAAGGAAACTTGCCAATAAGAAGCAAGAGGCAAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CYP1B1(1545), CYP1B1(1545)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Francesca Cirillo et al.
Oncotarget, 8(63), 106608-106624 (2018-01-02)
The cytochrome P450 1B1 (CYP1B1) is a heme-thiolate monooxygenase involved in both estrogen biosynthesis and metabolism. For instance, CYP1B1 catalyzes the hydroxylation of E2 leading to the production of 4-hydroxyestradiol that may act as a potent carcinogenic agent. In addition...
Inik Chang et al.
Oncotarget, 6(10), 7774-7787 (2015-04-11)
Despite high protein expression and enzymatic activity of cytochrome P450 1B1 (CYP1B1) in renal cell cancer (RCC), its functional significance has not been elucidated. Here we explored the functional role and regulatory mechanism of CYP1B1 in RCC. Reduction of CYP1B1...
Yozo Mitsui et al.
BMC cancer, 15, 942-942 (2015-12-03)
Cytochrome P450 1B1 (CYP1B1) has been shown to be up-regulated in many types of cancer including renal cell carcinoma (RCC). Several reports have shown that CYP1B1 can influence the regulation of tumor development; however, its role in RCC has not...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.