EHU016811

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPRJ

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCTGGAACCAAGTATTGCTTTGAAATAGTTCCAAAAGGACCAAATGGGACTGAAGGGGCATCTCGGACAGTTTGCAATAGAACTGTTCCCAGTGCAGTGTTTGACATCCACGTGGTCTACGTCACCACCACGGAGATGTGGCTGGACTGGAAGAGCCCTGACGGTGCTTCCGAGTATGTCTACCATTTAGTCATAGAGTCCAAGCATGGCTCTAACCACACAAGCACGTATGACAAAGCGATTACTCTCCAGGGCCTGATTCCGGGCACCTTATATAACATCACCATCTCTCCAGAAGTGGACCACGTCTGGGGGGACCCCAACTCCACTGCACAGTACACACGGCCCAGCAATGTGTCCAACATTGATGTAAGTACCAACACCACAGCAGCAACTTTAAGTTGGCAGAACTTTGATGACGCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Yiting Sun et al.
Journal of Cancer, 11(9), 2667-2678 (2020-03-24)
CD148 is a member of the receptor-type protein tyrosine phosphatase family encoded by the PTPRJ gene and has controversial impacts on cancers. In this study, we investigated the clinical significance of CD148 in gastric cancer and the possible mechanisms. Suppressed...
Gregory C Sartor et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(45), 15062-15072 (2015-11-13)
Epigenetic processes that regulate histone acetylation play an essential role in behavioral and molecular responses to cocaine. To date, however, only a small fraction of the mechanisms involved in the addiction-associated acetylome have been investigated. Members of the bromodomain and...
K Spring et al.
Oncogene, 34(44), 5536-5547 (2015-03-17)
DEP-1/PTPRJ is a receptor-like protein tyrosine phosphatase mainly known for its antiproliferative and tumor-suppressive functions. Many identified substrates are growth factor receptors, and DEP-1 is deleted and/or mutated in human cancers including that of the breast. However, DEP-1 was also...
Xiaoling Luo et al.
OncoTargets and therapy, 8, 3159-3167 (2015-11-26)
Interaction between microRNA (miR-328) and PTPRJ (protein tyrosine phosphatase, receptor type, J) has been reported to be responsible for miR-328-dependent increase in epithelial cancer cell proliferation. However, the role of miR-328 and PTPRJ in hepatocellular carcinoma (HCC) remains unclear. The...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service