EHU019931

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF11

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Wei Zhang et al.
Advanced healthcare materials, 5(12), 1493-1504 (2016-04-26)
Developing RNA-interference-based therapeutic approaches with efficient and targeted cytosolic delivery of small interfering RNA (siRNA) is remaining a critical challenge since two decades. Herein, a multifunctional transferrin receptor (TfR)-targeted siRNA delivery system (Tf&INF7) is designed based on siRNA complexes formed...
Kai Zhu et al.
American journal of translational research, 11(4), 2245-2256 (2019-05-21)
Micro RNA (miRNAs) is a kind of non coding small RNAs with negative regulation function, which plays an important role in regulating the occurrence and development of tumors. In this study, we analyzed the expression level and role of miRNA-186-5p...
Takeharu Imai et al.
Anticancer research, 37(1), 47-55 (2016-12-25)
Oesophageal squamous cell carcinoma (ESCC) and colorectal cancer (CRC) are common types of human cancer. Spheroid colony formation is used to characterize cancer stem cell (CSCs). In the present study, we analyzed the significance of kinesin family 11 (KIF11 in...
Tatsuya Kato et al.
Molecular cancer research : MCR, 16(1), 47-57 (2017-10-11)
Inhibiting specific gene expression with siRNA provides a new therapeutic strategy to tackle many diseases at the molecular level. Recent strategies called high-density lipoprotein (HDL)-mimicking peptide-phospholipid nanoscaffold (HPPS) nanoparticles have been used to induce siRNAs-targeted delivery to
Benjamin Steinborn et al.
The journal of gene medicine, 20(7-8), e3041-e3041 (2018-06-28)
Developing new drug delivery carriers addressing chemoresistance is still full of challenges and opportunities. As the rapid development of small interfering RNA (siRNA) provides promising therapeutic perspectives, nanocarriers for drug and siRNA co-delivery present new alternatives for cancer therapy. A...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.