EHU071991

Sigma-Aldrich

MISSION® esiRNA

targeting human VCP

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VCP(7415), VCP(7415)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Inhibition of p97/VCP function leads to defective autophagosome maturation, cell cycle arrest and apoptosis in mouse Sertoli cells.
Cayli, et al.
Theriogenology, 158, 196-206 (2020)
Wallaya Phongphaew et al.
Virus research, 228, 114-123 (2016-12-05)
Valosin-containing protein (VCP) is classified as a member of the type II AAA
Richard Wargachuk et al.
Cellular signalling, 30, 50-58 (2016-11-27)
GPCRs form signalling complexes with other receptors as part of dimers, G proteins and effector partners. A proteomic screen to identify proteins that associate with the β
Katrin Schweitzer et al.
Journal of cellular and molecular medicine, 20(1), 58-70 (2015-10-16)
Cullin-RING-ubiquitin-ligase (CRL)-dependent ubiquitination of the nuclear factor kappa B (NF-κB) inhibitor IκBα and its subsequent degradation by the proteasome usually precede NF-κB/RelA nuclear activity. Through removal of the CRL-activating modification of their cullin subunit with the ubiquitin (Ub)-like modifier NEDD8...
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.